I am interesting in post-DADA2 clustering of ASVs for more general animal biodiversity questions at the species or genus-level using, in this case, the CO1 marker. While the ASVs are very interesting for looking at sub-species (or cryptic species) questions, for comparisons of metabarcoding-based biodiversity to morphological-based inferences of biodversity (microscope based ID of species), it is preferable to work with clustered OTUs (e.g. 97% OTUs) from my pipeline. I have seen this being done recently and have even seen comments in other DADA2 threads about post-clustering with e.g. vsearch. My question is, how would one approach updating (generating) the resultant, more clustered OTU count table (presumably with fewer ASVs or OTUs) based on the new set of OTUs?
Would I use the OTU table?: e.g.
| OTUid | Sample1 | Sample2 | Sample3 | |
|-------|---------|---------|---------|---|
| Seq1 | 100 | 237 | 1 | |
| Seq2 | 0 | 32 | 399 | |
| Seq3 | 90 | 1 | 0 | |
Or just re map the filtered merged sequences (from previous DADA2 step) back to these new ASVs (e.g. the centroids fasta file produced from vsearch clustering) and rebuild the OTU table? How to keep track of sample names and abundances of dereplicated seqs from all the samples/groups?
Anyway, I wonder if someone has done this within DADA2 or if this is something vsearch has capabilities for? Any suggestions on the approach would be much appreciated!
LP
@mikemc @digitalwright Any thoughts on useful OTU clustering methods in R?
If there is tree already available, we use glomming in phyloseq.
On Fri, Feb 14, 2020, 18:27 Benjamin Callahan notifications@github.com
wrote:
@mikemc https://github.com/mikemc @digitalwright
https://github.com/digitalwright Any thoughts on useful OTU clustering
methods in R?—
You are receiving this because you are subscribed to this thread.
Reply to this email directly, view it on GitHub
https://github.com/benjjneb/dada2/issues/947?email_source=notifications&email_token=AAJFZPNFRV5CLIGFNVWUG4DRC5HHTA5CNFSM4KVP25U2YY3PNVWWK3TUL52HS4DFVREXG43VMVBW63LNMVXHJKTDN5WW2ZLOORPWSZGOEL27LOI#issuecomment-586544569,
or unsubscribe
https://github.com/notifications/unsubscribe-auth/AAJFZPL4IFDW6TI2O4VHYWTRC5HHTANCNFSM4KVP25UQ
.
You can align your sequences with DECIPHER using AlignSeqs or AlignTranslation and then cluster them into OTUs at a specific similarity level with DistanceMatrix and IdClusters. Once you have the cluster numbers it is relatively simple to collapse an ASV table into an OTU table using tapply or the like.
So far I have done it manually, similar to @digitalwright 's suggestion, but with Biostrings::stringDist() to compute the distance matrix, hclust(d, method="complete") to perform the clustering, and cuttree() to get the groups, and then collapsing the abundance table manually with dplyr functions. I have considered implementing a new glom function in speedyseq to do this operation on phyloseq objects but which precise distance and clustering method matches the agreed upon definition of "a 97% OTU" (if such a definition exists). In particular, how should the distance matrix account for variation in ASV length and which clustering method (average, complete, etc).
Phyloseq's tip_glom() function is doing something similar except it uses ape::cophenetic.phylo() to compute a distance matrix from the tree and uses cluster::agnes() for the clustering by default (which uses method = "average" by default).
Often OTUs are defined as all sequences being within a percent similarity. This corresponds to complete-linkage. The ends of sequences are typically ignored because the different lengths are due to missing data, as opposed to indels. The approach I described previously is what I think you are trying to do, and it is designed to assign cluster numbers very quickly.
@lplough Some code to do what @digitalwright and I discussed without using phyloseq is as follows. This code assumes that seqtab is the final sequence table produced by DADA2.
library(tibble)
library(dplyr)
# Packages that are required but not loaded:
# library(DECIPHER)
# library(Biostrings)
nproc <- 4 # set to number of cpus/processors to use for the clustering
asv_sequences <- colnames(seqtab)
sample_names <- rownames(seqtab)
dna <- Biostrings::DNAStringSet(asv_sequences)
## Find clusters of ASVs to form the new OTUs
aln <- DECIPHER::AlignSeqs(dna, processors = nproc)
d <- DECIPHER::DistanceMatrix(aln, processors = nproc)
clusters <- DECIPHER::IdClusters(
d,
method = "complete",
cutoff = 0.03, # use `cutoff = 0.03` for a 97% OTU
processors = nproc)
## Use dplyr to merge the columns of the seqtab matrix for ASVs in the same OTU
# prep by adding sequences to the `clusters` data frame
clusters <- clusters %>%
add_column(sequence = asv_sequences)
merged_seqtab <- seqtab %>%
# setup: turn seqtab into a tibble with rows = ASVs and columns = samples
t %>%
as_tibble(rownames = "sequence") %>%
# add the cluster information
left_join(clusters, by = "sequence") %>%
# merge ASVs in the same cluster, summing abundances within samples
group_by(cluster) %>%
summarize_at(vars(-sequence), sum) %>%
# Set new taxa names to OTU<cluster #>
mutate(cluster = paste0("OTU", cluster)) %>%
# convert back to a matrix in the original orientation
column_to_rownames("cluster") %>%
as("matrix") %>%
t
Now merged_seqtab is the new abundance table with ASVs combined into OTUs, and cluster can be saved to keep the map from the original ASV sequences to OTUs. Here I'm keeping things simple by making OTU names from the cluster numbers, so the OTUs are no longer going to be ordered from most to least abundant like in the original sequence table.
Edit: Fixed cluster_tbl -> clusters
This looks correct. I'll just point out that you could do the last step without dplyr using base::rowsum.
Oh, yes that is much simpler. You can replace the last part (the long pipe chain) with e.g.
merged_seqtab <- seqtab %>%
t %>%
rowsum(clusters$cluster) %>%
t
# Optional renaming of clusters to OTU<cluster #>
colnames(merged_seqtab) <- paste0("OTU", colnames(merged_seqtab))
Yes, ok and great thanks for this post!
But now what about the sequence for taxonomic assignment? Where are there? How to get them
as ASVs have been merged according clustering results??
@gomgom83 If you use phyloseq, then you might want to use the merge_taxa_vec() function I made for this purpose, now included in the speedyseq package. See the example here.
Yes of course I use Phyloseq after preprocessing with dada2. Ok I just see your page. I will try this and give you feedback! It a litle bit strange to make OTU clustering after denoising with dada2.
But finaly, dada2 seems to give a lot of more ASVs vs. OTUs (with qiime) an probably because
of it sensitivity for identifying 16S multicopies & strain level... that is a little pb when you want to
be at a species level (gather strain & 16S copy togheter) even if 97/98/99% ID for clutering is really arbitrary!, doesn't make sense (biologically)!! really difficult to find the good way for analysis.
thanks michael
Fa
Thanks for all, it works!
Hi everyone,
I need to cluster my ASVs sequences in OTUs (99%), so I followed these indications and everything
was great. Once I got the new phyloseq object, I made son filtering and then, export the OTU table in a csv file with the package "microbiome". I opened the file with excel and to confirm the clustering I took the sequences of two different OTU (what I know are very similar) and made a BLAST with NCBI tool. The BLAST result indicates that these sequences have a 99.6% percent identity. So, are those two OTUs supposed to be grouped into a single OTU because their similarity is greater than 99%?
I attach my script and a BLAST screenshot.
library(tibble)
library(dplyr)
install.packages("DECIPHER")
BiocManager::install("DECIPHER")
BiocManager::install("Biostrings")
install.packages("remotes")
remotes::install_github("mikemc/speedyseq")
asv_sequences <- colnames(seqtab.nochim)
sample_names <- rownames(seqtab.nochim)
dna <- Biostrings::DNAStringSet(asv_sequences)
nproc <- 8 # Increase to use multiple processors
aln <- DECIPHER::AlignSeqs(dna, processors = nproc)
d <- DECIPHER::DistanceMatrix(aln, processors = nproc)
clusters <- DECIPHER::IdClusters(
d,
method = "complete",
cutoff = 0.01, # corresponds to 99% OTUs
processors = nproc
)
merged_seqtab <- seqtab %>%
t %>%
rowsum(clusters$cluster) %>%
t
ps0 <- merge_taxa_vec(
ps,
group = clusters$cluster,
tax_adjust = 2
)
especies<-subset_samples(ps0, Specie!="Neivamyrmex pilosus")
especiesNC <- subset_taxa(especies, !is.na(Kingdom) & !Kingdom %in% c("", "Eukaryota"))
especiesNC <- subset_taxa(especiesNC, !is.na(Kingdom) & !Kingdom %in% c("", "NA"))
especiesNC <- subset_taxa(especiesNC, !is.na(Order) & !Order %in% c("", "Chloroplast"))
write_phyloseq(especiesNC, p = "E:/Documentos/ArmyAnts/Especies/OTU/")
write_phyloseq(especiesNC, type = "TAXONOMY", p = "E:/Documentos/ArmyAnts/Especies/OTU")

You are using method="complete" in IdClusters(). This is complete-linkage clustering, so all sequences assigned to a cluster will be within X% cutoff. However, sequences can be split across different clusters that still meet the cutoff. This is because distance values are non-transitive. If you want to guarantee that sequences within X% are clustered together then use single-linkage clustering (method="single").
Also, note that distances are based off of your multiple sequence alignment. BLAST reports local percent identity, although in this particular case the query coverage was 100%. In general, the distance matrix is not expected to exactly equal the BLAST percent identity.
Thank you very much, I think I got it!
This is exactly what I was hoping for! Thanks for sharing your code and advice @mikemc and @digitalwright. However, when I run this on my DADA2 seqtab, I get this error:
Error in tbl_vars_dispatch(x) : object 'cluster_tbl' not found
Was cluster_tbl supposed to be created before running the last set of piped scripts (to create the merged_seqtab clustered table)? It doesnt exist as an object yet. What am I missing?
@lplough thanks for catching this; cluster_tbl should have been named clusters in https://github.com/benjjneb/dada2/issues/947#issuecomment-589178796 - I fixed that now. However, you are better off replacing the computation of merged_seqtab (everything below ## Use dplyr ...) with the simpler code in https://github.com/benjjneb/dada2/issues/947#issuecomment-589237919
Thanks @mikemc ! And just to be clear, the renaming of col names by OTU colnames(merged_seqtab) <- paste0("OTU", colnames(merged_seqtab)) refers to the original ASV seqs _before_ 'clustering', correct? i.e. the sequences would map across the column names, the OTUs (if I wanted to, but obviously would make an ugly table), like this:
colnames(merged_seqtab)<-clusters$sequence[1:length(colnames(merged_seqtab))]
I'm answering this away from an R terminal, so you will want to check what I say here for yourself (e.g. check the docs and output for IdClusters() and the rowsum() and the column names before and after renaming).
And just to be clear, the renaming of col names by OTU
colnames(merged_seqtab) <- paste0("OTU", colnames(merged_seqtab))refers to the original ASV seqs _before_ 'clustering', correct? i.e. the sequences would map across the column names, the OTUs (if I wanted to, but obviously would make an ugly table), like this:
colnames(merged_seqtab)<-clusters$sequence[1:length(colnames(merged_seqtab))]
I don't really understand the question - there will be fewer OTUs than ASVs, so it is not possible for the ASV sequences to map across OTUs. Here's some more info that hopefully helps some.
After merging, each column represents an OTU. What you call these OTUs is arbitrary and up to you. By default, the rowsum() function set the names based on the group argument, which was clusters$cluster - this is just an integer indexing of the clusters and has nothing to do with the original ASVs. I don't think it's a good idea to leave the taxa names as an integer so I suggested changing e.g. 26 -> OTU26. The link between cluster id number and ASVs is in the clusters table.
How these new OTUs are ordered depends on the reorder argument to rowsum(). By default, rowsum() reorders the rows (which are the columns, before and after transposing with t()), based on clusters$cluster. So as shown above you cannot assume any relationship between the new column order and the original ASVs. Setting reorder = FALSE keeps the original order but there is not a 1-1 correspondence between ASVs and OTUs so you'll still have to use the clusters to link ASVs with OTUs.
If you would prefer that the OTU names be set to the most abundant ASV in each cluster, then you might consider using the merge_taxa_vec() function I wrote (though this requires first converting your sequence table to a phyloseq otu_table object with otu_table(seqtab, taxa_are_rows = FALSE))
Ok. Sorry, I wasn't being clear. What Id like is to make the column names of the merged OTU table the sequences e.g.
TAAAGAGGAACG TAACGGGTTCG TACCCACTACTCC
Sample1 10 0 12
Sample2 200 722 300
Sample3 3 400 100
or at least produce a file with the sequences in the order of the new clustered OTUs.
Since I will be doing my taxonomic assignment outside of DADA2 (after this clustering step), I need to know the sequence that corresponds with each 'new' OTU in the new merged table.
So, with my cluster mappings looking like this (originally 43 ASV sequences or OTUs and now 27 sequences/OTUs after clustering):
> clusters
cluster
1 18
2 4
3 20
4 25
5 3
6 2
7 1
8 5
9 13
10 1
...
37 26
38 14
39 17
40 23
41 22
42 24
43 27
my question really is, how to map the 27 clustered sequences to the 27 OTUs in my new table? e.g. OTU 27 would be the sequence from the Original ASV sequence # 43, right? But then for OTU 1 (and others), which merged multiple sequences , #7, #10 (and others not shown), any of the collapsed/clustered sequences could be extracted for that OTU now. Is there a simple way to extract the 27 clustered sequences from the new merged table so I know what sequence goes with what clustered OTU?
Hopefully my question is clearer now?
Not too much code to create such a file. I was thinking of some basic code like this, using the ASV sequences and cluster to ASV mappings from clusters object that would reflect the order of OTUs in merged_seqtab (the output from my dummy example below with 27 clustered ASVs):
> merged_seqtab
OTU1 OTU2 OTU3 OTU4 OTU5 OTU6 OTU7 OTU8 OTU9 OTU10 OTU11 OTU12 OTU13 OTU14
Ben 643 1115 452 298 810 176 94 17 15 34 29 139 195 8
Tom 643 1115 452 298 810 176 94 17 15 34 29 139 195 8
OTU15 OTU16 OTU17 OTU18 OTU19 OTU20 OTU21 OTU22 OTU23 OTU24 OTU25 OTU26
Ben 56 128 4 718 11 670 129 3 4 3 468 9
Tom 56 128 4 718 11 670 129 3 4 3 468 9
OTU27
Ben 2
Tom 2
_(yes my two dummy samples, Ben and Tom, have identical sequence counts for each OTU - I just duplicated a sample for testing and creating the OTU table)_
So, first make a new dataframe where ASV is column of all the original ASV sequences and C.ASV is the new column of clustered ASVs based on the mapping to those orig. ASVs.
library(dplyr)
newdf<-as.data.frame(cbind.data.frame(rownames(clusters),clusters$cluster,clusters$sequence))
colnames(newdf)<-c("ASV","C.ASV","sequence")
Then arrange by C.ASV and keep only the first of duplicated ASVs (there are 27 clustered ASVs in my dummy example from an original 43 DADA2 ASVs):
newdf.sort<-newdf %>% arrange(C.ASV) %>% distinct(C.ASV,.keep_all = TRUE)
Finally, create a fasta file of the new OTUs for taxonomic assignment, in thier proper order (to match the OTUs in merged_seqtab) :
fas<-paste(">OTU",seq(1:nrow(newdf.sort)),"\n",newdf.sort$sequence,sep="")
write.table(fas,file="out.fas", row.names=FALSE, col.names=FALSE,quote = FALSE)
user@ubuntu:~/DADA2_work$ head out.fas
>OTU1
TTTATCTGATTCTAAATTTCATTCAGGAATTTCTGTTGATTTAGCTATTTTTAGTTTACACATTGCTGGTATTTCTTCTATTTTAGGAAGGATTAATTTTATAACTACTATTATTTGTTCACGTACTACTAAGATAGTTAGCATAGATCGACTACCTTTAATGATTTGATCTTTAGGAGTTACAGCCTTTTTACTAGTTACTACTTTACCTGTTCTAGCTGGGGCAATTACTATACTATTAACTGATCGTAATTTCAATACATCTTTTTTCGATCCTTCAGGAGGAGGTAATCCTGTTCTATACCAACATTTATTT
>OTU2
TTTATCAAGAAACTTAGCACATGCAGGCCCTTCTGTAGATCTAGCTATTTTTTCTCTTCATTTAGCCGGTATTTCATCCATTCTAGGAGCACTAAATTTTATAACAACAGTAATTAATATACGCTCAAAAGGGCTTCGAATAGAATTAATACCTTTATTTATTTGAGCTTTATTTATTACAGCCATTCTTCTTCTCTTATCTTTACCCGTTTTAGCAGGAGGTATTACTATACTTTTAACAGACCGTAATCTAAACACAGCATTCTTCGATCCTGCAGGGGGAGGAGATCCTGTCTTGTTTCAGCATTTATTT
>OTU3
CCTGTCTAGAAATATTGCTCACGCAGGTAGGTCTGTCGATTTTGCCATTTTTTCACTTCACTTAGCAGGTGTTAGTTCTATTTTAGGGGCGGTAAACTTTATTAGAACTTTGGGTAACTTACGTGCATTCGGTATAATTTTAGATCGAATGCCTCTTTTTGCTTGGTCTGTGTTAATTACTGCAGTTCTTCTTCTTTTATCACTTCCTGTACTAGCAGGCGCTATTACTATATTATTAACAGATCGTAATCTAAATTCAAGATTTTATGACGCAAGTGGAGGGGGAGATCCGATTTTGTATCAACACCTGTTC
Most helpful comment
@lplough Some code to do what @digitalwright and I discussed without using phyloseq is as follows. This code assumes that
seqtabis the final sequence table produced by DADA2.Now
merged_seqtabis the new abundance table with ASVs combined into OTUs, andclustercan be saved to keep the map from the original ASV sequences to OTUs. Here I'm keeping things simple by making OTU names from the cluster numbers, so the OTUs are no longer going to be ordered from most to least abundant like in the original sequence table.Edit: Fixed
cluster_tbl->clusters